Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0028p23_852

[Submit comment/correction]

Sequence	tplb0028p23_852
Contig	3DS_2595431
Probe	tplb0028p23_852
DNA Homology	3DS_2595431 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 3DS_2595431 Best IWGSC match
DNA	atgggaggatgcttgctatttgactcggacatcccttaggatgcctgcta Rcacatggcaaaatattgatgagtttacgaaggaggatctcgtcatgaag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.