Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c4907_291

[Submit comment/correction]

Sequence	RAC875_c4907_291
Contig	3AS_3340510
Probe	RAC875_c4907_291
DNA Homology	3AS_3340510 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3AS_3340510 Best IWGSC match
DNA	tggtggcacaggtcacatcggcaagcatatcgttgctgcgagtgtccgcc Rcggccacccgacctctgtcctcatcagggatgctgcaccggctgatctg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.