Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_4175147

[Submit comment/correction]

Sequence	BobWhite_rep_c55395_200
Contig	3B_4175147
Probe	BobWhite_rep_c55395_200
DNA Homology	3B_4175147 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 3B_4175147 Best IWGSC match
DNA	cgggcatcgcatgagaagacgaggagggtggcagccatgaccaccatgag Rgcggccgcgaagccgcagcacatcagggagttcgtgttcttcttcagca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.