Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3DS_1858687

[Submit comment/correction]

Sequence	RAC875_c25375_236
Contig	3DS_1858687
Probe	RAC875_c25375_236
DNA Homology	3DS_1858687 Best IWGSC match 172 7.00005e-41 URGI_Best IWGSC_N
BLAST, e-value	7.00005e-41 3DS_1858687 Best IWGSC match
DNA	tgtgtaactcctttcactccaacctccatcccgatttgcagcacatccac Magcagcttctcattcaaaaactgctccccaaagtgtggccatgcgatca t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.