Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3DS_2585764

[Submit comment/correction]

Sequence	TA005743-0552
Contig	3DS_2585764
Probe	TA005743-0552
DNA Homology	3DS_2585764 Best IWGSC match 94 2e-17 URGI_Best IWGSC_N
BLAST, e-value	2e-17 3DS_2585764 Best IWGSC match
DNA	tagctttacctggcaaggaggtttccaagttctggggatctcaagaatat Ra

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.