Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10694393

[Submit comment/correction]

Sequence	RFL_Contig738_557
Contig	3B_10694393
Probe	RFL_Contig738_557
DNA Homology	3B_10694393 Best IWGSC match 126 5e-27 URGI_Best IWGSC_N
BLAST, e-value	5e-27 3B_10694393 Best IWGSC match
DNA	cccagatgtccacgaggaaatcaaccatctcatgtagagggatgggctgc Rtgaatggtttatttgatccaagcaaactttcatacgctgcattccaact c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.