Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_JD_rep_c53979_36270209

[Submit comment/correction]

Sequence	wsnp_JD_rep_c53979_36270209
Contig	6DL_1440336
Probe	wsnp_JD_rep_c53979_36270209
DNA Homology	6DL_1440336 Best IWGSC match 180 8.99634e-43 URGI_Best IWGSC_N
BLAST, e-value	8.99634e-43 6DL_1440336 Best IWGSC match
DNA	tgtcccgacggcaccgacgagccagggacatccgcgtgcccggaggcgaa attctactgcaagaatgccggacattctccaatcaccatcttctcgtcgc Ragtgaatgatggtatatgcgattgctgtgrcgggagtgatgaatacggt agcaatagcacttgcaagaatacatgctgggaagctggcaargcggcgag g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.