Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_BQ168706B_Ta_2_2

[Submit comment/correction]

Sequence	wsnp_BQ168706B_Ta_2_2
Contig	3B_10638690
Probe	wsnp_BQ168706B_Ta_2_2
DNA Homology	3B_10638690 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 3B_10638690 Best IWGSC match
DNA	TTCTGATCATATTTGTAGGTTGTATTGGTGCGACTTGCCCCTGCTTTCTC TTTGGAAAAARTGCACAGTTCTTGGGATCTGGAACTCTCGCTGGATCAT

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.