Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c93850_278

[Submit comment/correction]

Sequence	Excalibur_c93850_278
Contig	3B_10625520
Probe	Excalibur_c93850_278
DNA Homology	3B_10625520 Best IWGSC match 161 1e-37 URGI_Best IWGSC_N
BLAST, e-value	1e-37 3B_10625520 Best IWGSC match
DNA	gcgtggtgatggcatggtgacgcaagaaggtcgtgttcctggtgtgccgc Rtgctccgtctccatccacgtccgcgaccgcaagacagggagatgcatct g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.