Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IACX3190

[Submit comment/correction]

Sequence	IACX3190
Contig	3B_10695031
Probe	IACX3190
DNA Homology	3B_10695031 Best IWGSC match 213 0 URGI_Best IWGSC_N
BLAST, e-value	0 3B_10695031 Best IWGSC match
DNA	tcgacctggaaaggctgcacctgggcgatcctttccgggatcgcctggcc acgctccacRcgagcaagaacttcatagtgcgctctcaacttgttgggct ttgttttccactcaggcaag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.