Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10450201

[Submit comment/correction]

Sequence	Excalibur_c85790_65
Contig	3B_10450201
Probe	Excalibur_c85790_65
DNA Homology	3B_10450201 Best IWGSC match 113 4e-23 URGI_Best IWGSC_N
BLAST, e-value	4e-23 3B_10450201 Best IWGSC match
DNA	caggtggatggaccaggctccggcaccaccgtcgagctgaagttctgcgc Rtcctgctcctacaagggaaatgcgatgaccatgaagcgcatgctggata c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.