Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c57807_342

[Submit comment/correction]

Sequence	Excalibur_c57807_342
Contig	5BL_10918550
Probe	Excalibur_c57807_342
DNA Homology	5BL_10918550 Best IWGSC match 147 4e-33 URGI_Best IWGSC_N
BLAST, e-value	4e-33 5BL_10918550 Best IWGSC match
DNA	gccatcccaacacggatccgacggaaacaatggagaaaatgatttccctc Rgccagatccatggacgaggaccgcgtcctctgaagatccggtgttgcgc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.