Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: D_contig23500_480

[Submit comment/correction]

Sequence	D_contig23500_480
Contig	3AL_2426440
Probe	D_contig23500_480
DNA Homology	3AL_2426440 Best IWGSC match 150 9e-34 URGI_Best IWGSC_N
BLAST, e-value	9e-34 3AL_2426440 Best IWGSC match
DNA	ccttccgtctgggacgtcggcgacgactggcaggtaaagctccgggacgg tctggagagatggttgtcctccagccctaatcttctgggaaacccgatca ggtaaagtggggacgtccaaagaaaRgacagtgtccctgacctgggagct cgaaaagccggcagcgcgcataacgcggtcgacgctggggtcgtcgagga tggagacgatgagctgcttgagctcgaccttgtcgccgcccacggcgccc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.