Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3B_10530150

[Submit comment/correction]

Sequence	BobWhite_rep_c53007_100
Contig	3B_10530150
Probe	BobWhite_rep_c53007_100
DNA Homology	3B_10530150 Best IWGSC match 106 7e-21 URGI_Best IWGSC_N
BLAST, e-value	7e-21 3B_10530150 Best IWGSC match
DNA	ggcggctccatccgcaaggtcgcaaacttcagcggcgtggaggagcctca Rctgtcctctgcctacaagtttgacatcgagcgcgagccgttctgcatgt a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.