Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA002161-0606

[Submit comment/correction]

Sequence	TA002161-0606
Contig	3AL_4260437
Probe	TA002161-0606
DNA Homology	3AL_4260437 Best IWGSC match 71 9e-11 URGI_Best IWGSC_N
BLAST, e-value	9e-11 3AL_4260437 Best IWGSC match
DNA	aacgatgcgacgacatccattgatatatggaggacgcaggtctatgaaag Mga

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.