Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: TA009924-0526

[Submit comment/correction]

Sequence	TA009924-0526
Contig	3DL_6927522
Probe	TA009924-0526
DNA Homology	3DL_6927522 Best IWGSC match 97 2e-18 URGI_Best IWGSC_N
BLAST, e-value	2e-18 3DL_6927522 Best IWGSC match
DNA	gtagtgcatttgccaatggtaccaggcccttgaatacacctattgtagtc Rtag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.