Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c3200_1003

[Submit comment/correction]

Sequence	BobWhite_c3200_1003
Contig	3DL_4059783
Probe	BobWhite_c3200_1003
DNA Homology	3DL_4059783 Best IWGSC match 130 4e-28 URGI_Best IWGSC_N
BLAST, e-value	4e-28 3DL_4059783 Best IWGSC match
DNA	ttctttcctgggcttggatggatgctaacaaagtcaacatggatggagct Rtcaccaaagtggcccaaagcttattgggatgattgggtgaggctaaagg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.