Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_CAP11_c59_99263

[Submit comment/correction]

Sequence	wsnp_CAP11_c59_99263
Contig	3DL_6935062
Probe	wsnp_CAP11_c59_99263
DNA Homology	3DL_6935062 Best IWGSC match 139 2e-30 URGI_Best IWGSC_N
BLAST, e-value	2e-30 3DL_6935062 Best IWGSC match
DNA	cgctccccaggctaatgacggtgcagaaggtcagcagtgctgcctgrgcg ctgcttggtgtcattgagccctcgaaggtgatgacctcgccacggtcaga Racggcgaaactgttgcgcgtgaagaaggasaggatctccccggccgtaa ggtaccactctcgcttgtatccactgcttccctgacgaacgtcttctgca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.