Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV4641

[Submit comment/correction]

Sequence	IAAV4641
Contig	3AL_4451746
Probe	IAAV4641
DNA Homology	3AL_4451746 Best IWGSC match 289 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AL_4451746 Best IWGSC match
DNA	agcagtggtatccaacgcaagaggcctgaggagaggatccctgcggagag ggacccgaccaaggttgttgtctcRccaataaccggggagctcattccga tcagcgagatggaggaacacatgcgcatctcgctcattgaccccaagtac aaggaacagaaagaaagaatgctgg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.