Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1925_118

[Submit comment/correction]

Sequence	GENE-1925_118
Contig	3B_10763598
Probe	GENE-1925_118
DNA Homology	3B_10763598 Best IWGSC match 106 5e-21 URGI_Best IWGSC_N
BLAST, e-value	5e-21 3B_10763598 Best IWGSC match
DNA	ctgccggcaatcagtgtcgggagctgggttagagctgacaggcacgaggc Rctccctycgaagaacgtgtayacyygyacg

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.