Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c3956_659

[Submit comment/correction]

Sequence	RAC875_c3956_659
Contig	7AL_494510
Probe	RAC875_c3956_659
DNA Homology	7AL_494510 Best IWGSC match 152 8e-35 URGI_Best IWGSC_N
BLAST, e-value	8e-35 7AL_494510 Best IWGSC match
DNA	ccgggaggaattggaatcatacgaggcatttcacgaccatagcagctaac Rccacgctttattcttgctctaagtttcctctccataattacatcaaatc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.