Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c48906_80

[Submit comment/correction]

Sequence	RAC875_c48906_80
Contig	2BS_1409860
Probe	RAC875_c48906_80
DNA Homology	2BS_1409860 Best IWGSC match 165 1e-38 URGI_Best IWGSC_N
BLAST, e-value	1e-38 2BS_1409860 Best IWGSC match
DNA	cccccggagatcctccagcatcatgtgctcatcaagtatttcgaccccat Mcagctgggcgagatgaagaccaacgtcgccaagctggagaccatgttct c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.