Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 5AL_2687415

[Submit comment/correction]

Sequence	BobWhite_c43495_133
Contig	5AL_2687415
Probe	BobWhite_c43495_133
DNA Homology	5AL_2687415 Best IWGSC match 141 2e-31 URGI_Best IWGSC_N
BLAST, e-value	2e-31 5AL_2687415 Best IWGSC match
DNA	gcttcatattgttagctccaatgcactcatcctggcagcacatgggggcc Rttcatcaggcacacgcccaacacggattcttcgtccagccagggggctt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.