Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: IAAV2980

[Submit comment/correction]

Sequence	IAAV2980
Contig	3AS_3406679
Probe	IAAV2980
DNA Homology	3AS_3406679 Best IWGSC match 274 0 URGI_Best IWGSC_N
BLAST, e-value	0 3AS_3406679 Best IWGSC match
DNA	cgagagcacgaggccctgctgccacgcaagccgcgacagacacgacagca actgcaaatgccacagcaccagcagcaagccacggcagcagcagcaacat Mctacagcaagctcatccaagaagcagcccaacaagaaccatgcccacaa gctatcggcgctc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.