Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0050o09_895

[Submit comment/correction]

Sequence	tplb0050o09_895
Contig	3AS_3338633
Probe	tplb0050o09_895
DNA Homology	3AS_3338633 Best IWGSC match 71 2e-10 URGI_Best IWGSC_N
BLAST, e-value	2e-10 3AS_3338633 Best IWGSC match
DNA	cgatcgtgggcttcctctgcggcggcaggggcgcgtccagcagggtggtc Rtcgtcggtcgctccgtcacaggagcgcctggaacgaactagccagctag c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.