Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c114833_645

[Submit comment/correction]

Sequence	Excalibur_rep_c114833_645
Contig	3DS_2587382
Probe	Excalibur_rep_c114833_645
DNA Homology	3DS_2587382 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 3DS_2587382 Best IWGSC match
DNA	gcacccccgccacagcaagtaaattatgatgatcaaagtggagcccttcc Rcctccgccttgggaggctccggcagcgtcaagcaatgaaatgccaaatg g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.