Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c33823_279

[Submit comment/correction]

Sequence	RAC875_c33823_279
Contig	3DL_6858436
Probe	RAC875_c33823_279
DNA Homology	3DL_6858436 Best IWGSC match 119 9e-25 URGI_Best IWGSC_N
BLAST, e-value	9e-25 3DL_6858436 Best IWGSC match
DNA	tgtaggtcaccaaggacgtctgcccagtcatcttccatgacaacttcatc Rttactgaagaacatggcaaaatttcagagaagcgtgtcactgatcttca g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.