Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: JD_c5179_633

[Submit comment/correction]

Sequence	JD_c5179_633
Contig	3DL_6912981
Probe	JD_c5179_633
DNA Homology	3DL_6912981 Best IWGSC match 130 4e-28 URGI_Best IWGSC_N
BLAST, e-value	4e-28 3DL_6912981 Best IWGSC match
DNA	tgagagagcttgcccatcgggaagaggatctgaatgaacccaaagacgag Maacatgatgagagaagcaaataggaaaggaccaaggaagctgaagtcct g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.