Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c30545_131

[Submit comment/correction]

Sequence	BobWhite_c30545_131
Contig	1BS_3468506
Probe	BobWhite_c30545_131
DNA Homology	1BS_3468506 Best IWGSC match 128 1e-27 URGI_Best IWGSC_N
BLAST, e-value	1e-27 1BS_3468506 Best IWGSC match
DNA	ccctgctccgtcagatcagggtacatcttcccgcacttgcagtctgagcc Rcagctgcaaccggatccacagttgcaagacatcctccaaatctgatgaa a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.