Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-1166_419

[Submit comment/correction]

Sequence	GENE-1166_419
Contig	2AL_6426866
Probe	GENE-1166_419
DNA Homology	2AL_6426866 Best IWGSC match 182 9.94922e-44 URGI_Best IWGSC_N
BLAST, e-value	9.94922e-44 2AL_6426866 Best IWGSC match
DNA	tgttgcatattttcttaagctaaatgggcaatgcaaatcagtgcaggcct Rtgctgatgagatgggtattcctttcctagaaacaagtgctaaagagtcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.