Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c20791_845

[Submit comment/correction]

Sequence	Excalibur_c20791_845
Contig	3DL_2120104
Probe	Excalibur_c20791_845
DNA Homology	3DL_2120104 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 3DL_2120104 Best IWGSC match
DNA	gctgtctagccgccgtggtgagatacgcagaatccatgatgacaaccaac Rtctggcggatgaaattgttggactcaggcaagcaatgtcycgtttgaaa g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.