Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 3DL_6953523

[Submit comment/correction]

Sequence	BobWhite_c20641_267
Contig	3DL_6953523
Probe	BobWhite_c20641_267
DNA Homology	3DL_6953523 Best IWGSC match 122 7e-26 URGI_Best IWGSC_N
BLAST, e-value	7e-26 3DL_6953523 Best IWGSC match
DNA	cggaatcatgccctggagaatctgaggcatcaccccagacatcgtcgtcc Rcagcagcagcatcaccgttgccmacgcccattggttccttcctcccgcg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.