Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Ku_c766_36

[Submit comment/correction]

Sequence	Ku_c766_36
Contig	4AS_5983505
Probe	Ku_c766_36
DNA Homology	4AS_5983505 Best IWGSC match 150 2e-34 URGI_Best IWGSC_N
BLAST, e-value	2e-34 4AS_5983505 Best IWGSC match
DNA	tcgcggagacgcgagcaggcgatcgagggcggaggcgcggcaggaacgaa Rgctccaaagagagagagggaggaggccggagcrcc

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.