Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_c39621_358

[Submit comment/correction]

Sequence	Excalibur_c39621_358
Contig	4AS_5938894
Probe	Excalibur_c39621_358
DNA Homology	4AS_5938894 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 4AS_5938894 Best IWGSC match
DNA	gaggaggatgttgctggagtggatgctgggtttgatgagcatgatattcc Rtatgacgtgctctggctcgacattgaacacactgatggcaagcgatatt t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.