Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c36701_44603531

[Submit comment/correction]

Sequence	wsnp_Ex_c36701_44603531
Contig	4AS_5944693
Probe	wsnp_Ex_c36701_44603531
DNA Homology	4AS_5944693 Best IWGSC match 252 0 URGI_Best IWGSC_N
BLAST, e-value	0 4AS_5944693 Best IWGSC match
DNA	caacggctgcgcgacaagatagccatagcagagaggtctgcaaaggtgga agcccaacttaatgataaactcaaaaggagactgaaatctttggaagagg Mcatgagaaatggaaagcccaacacacctgccagtgatgccaataggaga ggcactccgaaaagatcaacatctcaaccaagacagccaagcacacccag a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.