Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: tplb0040n03_560

[Submit comment/correction]

Sequence	tplb0040n03_560
Contig	4DL_14453059
Probe	tplb0040n03_560
DNA Homology	4DL_14453059 Best IWGSC match 137 2e-30 URGI_Best IWGSC_N
BLAST, e-value	2e-30 4DL_14453059 Best IWGSC match
DNA	tacttgatggcctgctcgtacagctcgccgggcgagaggttgtagaggac Rtgggtgaacttgagggagctgtcgctgacgctgatggtgggtgcgacgt g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.