Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c37383_45143321

[Submit comment/correction]

Sequence	wsnp_Ex_c37383_45143321
Contig	4AL_7101670
Probe	wsnp_Ex_c37383_45143321
DNA Homology	4AL_7101670 Best IWGSC match 189 1.4013e-45 URGI_Best IWGSC_N
BLAST, e-value	1.4013e-45 4AL_7101670 Best IWGSC match
DNA	ggccgtttggagtctctctccttattgctggtcatgatgaacatggaccc agcttgtattacacagacccatcggggaccttttggcagtgcaaggccaa Rgccattgggtcgggctctgaaggagctgatagctcattacaagagcagt acaacaaggaactgaccatcgctgaggcagagaccatagccctttctatc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.