Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c39599_82

[Submit comment/correction]

Sequence	BobWhite_c39599_82
Contig	4AS_5947817
Probe	BobWhite_c39599_82
DNA Homology	4AS_5947817 Best IWGSC match 130 4e-28 URGI_Best IWGSC_N
BLAST, e-value	4e-28 4AS_5947817 Best IWGSC match
DNA	cctggggcaggctaggatcagagctccactcaaggtgaaatggcaagcct Rcagagcttgatatccaaacagttggttgcgccgaactgcacggccactg c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.