Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: RAC875_c38663_2179

[Submit comment/correction]

Sequence	RAC875_c38663_2179
Contig	4AS_5960677
Probe	RAC875_c38663_2179
DNA Homology	4AS_5960677 Best IWGSC match 111 1e-22 URGI_Best IWGSC_N
BLAST, e-value	1e-22 4AS_5960677 Best IWGSC match
DNA	aatccagaagaagcgagagaaagatggaagggacacggaactagataaac Rcaaaatgatggccggggatactggtaattcaagatttcatggtgattca c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.