Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_JD_c4217_5322858

[Submit comment/correction]

Sequence	wsnp_JD_c4217_5322858
Contig	4AS_6011322
Probe	wsnp_JD_c4217_5322858
DNA Homology	4AS_6011322 Best IWGSC match 145 3e-32 URGI_Best IWGSC_N
BLAST, e-value	3e-32 4AS_6011322 Best IWGSC match
DNA	ctgactgttttgcaaaagcagatgggtcttatgctcctaaagagaaaagg aagaagcaagaggagaaagctgctgagaaaaaacggcgaactgaagatgg Rcaacaacctggtgctagtgctcctgttgccccaagcaatggaactggtc atcaaccttctcgttttgccaagcctccgcaagagccagctgctccgccg a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.