Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_Ex_c23130_32358433

[Submit comment/correction]

Sequence	wsnp_Ex_c23130_32358433
Contig	4AS_5947817
Probe	wsnp_Ex_c23130_32358433
DNA Homology	4AS_5947817 Best IWGSC match 165 2e-38 URGI_Best IWGSC_N
BLAST, e-value	2e-38 4AS_5947817 Best IWGSC match
DNA	cagtagckcsrgcagcaacagatagccaaccaacctggggcaggctagga tgagagctccactcaaggtgaaatggcaagcctRcagagcttgatatcca aacagttgattgcgccgaactgcacggccactgccaggctgaacggggct cccccttcggtggtgaacgcgagctcgagcgaag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.