Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Excalibur_rep_c110721_506

[Submit comment/correction]

Sequence	Excalibur_rep_c110721_506
Contig	4AS_6009291
Probe	Excalibur_rep_c110721_506
DNA Homology	4AS_6009291 Best IWGSC match 180 3.9937e-43 URGI_Best IWGSC_N
BLAST, e-value	3.9937e-43 4AS_6009291 Best IWGSC match
DNA	cgcttttgccccgatcttctgagcttgcttggctgcctcagcaggactca Rgccttctgtcaaagcatcagccaacgctttctcaagggctcgctgcygc a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.