Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: wsnp_RFL_Contig25_2082245

[Submit comment/correction]

Sequence	wsnp_RFL_Contig25_2082245
Contig	4AL_7100654
Probe	wsnp_RFL_Contig25_2082245
DNA Homology	4AL_7100654 Best IWGSC match 178 1.00053e-42 URGI_Best IWGSC_N
BLAST, e-value	1.00053e-42 4AL_7100654 Best IWGSC match
DNA	aatacaaccaacgtttgcacggtagccagccaagagctagctagcgcatg Ratgaataggcgtaaaccctacgacgaatgcttcactgcaggttaaccag g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.