Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BobWhite_c10082_241

[Submit comment/correction]

Sequence	BobWhite_c10082_241
Contig	4DS_2219420
Probe	BobWhite_c10082_241
DNA Homology	4DS_2219420 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 4DS_2219420 Best IWGSC match
DNA	cgaccaaggaggcgccggtgctcgactacaagctcgcgctgctcttccag Mccatgctcatgctcgggatcaccatcggcgtcgagctcagcgtcgtctt c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.