Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7075859

[Submit comment/correction]

Sequence	Tdurum_contig47148_651
Contig	4AL_7075859
Probe	Tdurum_contig47148_651
DNA Homology	4AL_7075859 Best IWGSC match 183 2.94273e-44 URGI_Best IWGSC_N
BLAST, e-value	2.94273e-44 4AL_7075859 Best IWGSC match
DNA	cgtccgccgcgtggaccggccgcagcacctcaccttcctcgaccagatcc Rcgtcttcgtctcctcccagtcctagtgcaagatttggtcctcgctctat c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.