Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7175892

[Submit comment/correction]

Sequence	GENE-4618_519
Contig	4AL_7175892
Probe	GENE-4618_519
DNA Homology	4AL_7175892 Best IWGSC match 154 2e-35 URGI_Best IWGSC_N
BLAST, e-value	2e-35 4AL_7175892 Best IWGSC match
DNA	tgttttacttgaatctgatgacgtgcctgctgctataagcgaggaaatcg Rcaaattcaacattggcaagctggtcctgggctct

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.