Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: GENE-4621_247

[Submit comment/correction]

Sequence	GENE-4621_247
Contig	7AS_4246660
Probe	GENE-4621_247
DNA Homology	7AS_4246660 Best IWGSC match 159 5e-37 URGI_Best IWGSC_N
BLAST, e-value	5e-37 7AS_4246660 Best IWGSC match
DNA	tcagatcccctaccttgagatagtgctccatgaaaatctcccacgtcttc Rygttaagccttcctccycgcatcttggcacgcttcttgagag

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.