Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: 4AL_7141011

[Submit comment/correction]

Sequence	wsnp_Ku_c42833_50483239
Contig	4AL_7141011
Probe	wsnp_Ku_c42833_50483239
DNA Homology	4AL_7141011 Best IWGSC match 206 0 URGI_Best IWGSC_N
BLAST, e-value	0 4AL_7141011 Best IWGSC match
DNA	acatgcggctgcctatcctatacaccttatcttggccagaaagggtctat tgctctgagatcacctggccccggctagatctttgcgagttgggctcgct Racattcaaagctgtcgacaacgtgaaatacccatcggttgatctcgcat atgcagcagggcgagctgggggcaccatgccgggagttctgagtgccgct a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.