Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: Tdurum_contig46583_958

[Submit comment/correction]

Sequence	Tdurum_contig46583_958
Contig	4AL_7170232
Probe	Tdurum_contig46583_958
DNA Homology	4AL_7170232 Best IWGSC match 94 5e-17 URGI_Best IWGSC_N
BLAST, e-value	5e-17 4AL_7170232 Best IWGSC match
DNA	atggcggccacggcgaccctggtctcgctgatggccgcgggggtcatggc Rtcgatggcctcgggcgtcacccggacggtctccttggtggccatgtcgt a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.