Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Sequence Report: BS00082218_51

[Submit comment/correction]

Sequence	BS00082218_51
Contig	4DL_14283717
Probe	BS00082218_51
DNA Homology	4DL_14283717 Best IWGSC match 82 1e-13 URGI_Best IWGSC_N
BLAST, e-value	1e-13 4DL_14283717 Best IWGSC match
DNA	acgtgcgtgttctgctgctggaagttgcctatgccggtcatgccgctctc Rcccgccgcatgtatcaccacgcacgtcccgtcgtcgtcgccgtcgccgc c

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.